View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_400 (Length: 219)
Name: NF10104A_low_400
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_400 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 59 - 185
Target Start/End: Original strand, 7724134 - 7724260
Alignment:
| Q |
59 |
cattttatttgcttcctttggtggagtgagaatgtgagataattctatattcttagtttgtcnnnnnnnnnnnnatcgactactttaattaactttctct |
158 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7724134 |
cattttatttgcttcctttgatggagtgagaatgtgagataattctatattcttagtttgtctttttattttttatcgactactttaattaactttctct |
7724233 |
T |
|
| Q |
159 |
ttcagttagatgtataacaacctactt |
185 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
7724234 |
ttcagttagatgtataacaacctactt |
7724260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University