View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_406 (Length: 217)
Name: NF10104A_low_406
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_406 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 7e-76; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 21 - 168
Target Start/End: Complemental strand, 40456787 - 40456640
Alignment:
| Q |
21 |
atcacatgtgataccaattagtccttgaacaaatgacaacaagaaggaatcttagggtcagaattccatctctttgctggttatttctgtacatatgtgg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40456787 |
atcacatgtgataccaattagtccttgaacaaatgacaacaagaaggaatcttagggtcagaattccatctctttgctggttatttctgtatatatgtgg |
40456688 |
T |
 |
| Q |
121 |
tttgtaagtggttgaatttggatgtttactttctcttgccagtagatt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40456687 |
tttgtaagtggttgaatttggatgtttactttctcttgccagtagatt |
40456640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 106 - 168
Target Start/End: Complemental strand, 40482148 - 40482086
Alignment:
| Q |
106 |
tctgtacatatgtggtttgtaagtggttgaatttggatgtttactttctcttgccagtagatt |
168 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40482148 |
tctgtatatatgtggtttgtaagtggttgaatttggatgtttactttctcttgccagtagatt |
40482086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 21 - 73
Target Start/End: Original strand, 40362953 - 40363005
Alignment:
| Q |
21 |
atcacatgtgataccaattagtccttgaacaaatgacaacaagaaggaatctt |
73 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||| ||| ||||| |||||| |
|
|
| T |
40362953 |
atcaaatgtgataccaattagtccttgcacaaatgataactagaagaaatctt |
40363005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University