View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_409 (Length: 215)
Name: NF10104A_low_409
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_409 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 21 - 214
Target Start/End: Complemental strand, 36166948 - 36166756
Alignment:
| Q |
21 |
cattatgggaggggattactcgctttaggttcttcctagggatgtcttggaccattgctcttaggcgttgaaggaaggagatggtgattggggaccgaag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36166948 |
cattatgggaggggattactcgctttaggttcttcctagggatgtcttgggccattgctcttaggtgttgaaggaaggagatggtgattggggaccgaag |
36166849 |
T |
|
| Q |
121 |
ccatttagatttaataatcattagttgaataatagaaatttcaaaaggggtggaggagggggcttgggaagagtttcaagggattgggtagatg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| ||| |||| |||| |
|
|
| T |
36166848 |
ccatttagatttaataatcattagttgaataatagaaatttcaaaa-gggtggaggaggaggcttgggaagagtttcaagtgatcgggtggatg |
36166756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University