View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_410 (Length: 215)
Name: NF10104A_low_410
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_410 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 19 - 215
Target Start/End: Original strand, 40626123 - 40626319
Alignment:
| Q |
19 |
tcatccatgagtcgcacctttagcaggaccaatcctttttcagaaagatacaaaatgttttgtgacaacaacacttcttgtgctctctctcttctgtcat |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40626123 |
tcatccatgagtcgcacgtttagcaggaccaatcctttttcagaaagatacaaaatgttttgtgacaacaacacttcttgtgctctctctcttctgtcat |
40626222 |
T |
|
| Q |
119 |
caccagtaccacaaacacatgatcatcctgaaaatggattgaatcagatggtgaatactcgctcatcttttatgcaacccttaggcttgagtttgca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40626223 |
caccagtaccacaaacacatgatcatcctgaaaatggattgaatcagatggtgaatactcactcatcttttatgcaacccttaggcttgagtttgca |
40626319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University