View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_411 (Length: 215)
Name: NF10104A_low_411
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_411 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 15 - 215
Target Start/End: Original strand, 22362097 - 22362300
Alignment:
| Q |
15 |
ctcttaatactatggtatattctgttgcacttggattcacatgtggtgccatcattgatccctaacatacacaacgcatgaaaaagaaaagatgaataag |
114 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
22362097 |
ctcttaatactatggtatactctgttgcacttggattcacatgtggtgccatcattgatccctaacatacacaatgcatgaaatagaaaagatgaataag |
22362196 |
T |
 |
| Q |
115 |
aacc---cagcaagatcatggttaaaatatgtaaggtcttgtttgtttgcataccgcggtgagattgacgtgaaaaacaccgatatcaggtattttgagc |
211 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22362197 |
aacccagcagcaatatcatggttaaaatatgtaaggtcttgtttgtttgcataccgcggtgagattgacgtgaaaaacaccgatatcaggtattttgagc |
22362296 |
T |
 |
| Q |
212 |
ggag |
215 |
Q |
| |
|
|||| |
|
|
| T |
22362297 |
ggag |
22362300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University