View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_416 (Length: 213)
Name: NF10104A_low_416
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_416 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 22 - 193
Target Start/End: Complemental strand, 45655844 - 45655673
Alignment:
| Q |
22 |
atgttgtatgcccttgcttcaaacattttgaatgttttctcattctaaccaataatgcaaagttttttattggtttaaatgatgtgtttttacaggtagt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45655844 |
atgttgtatgcccttgcttcaaacattttgattgttttctcattctaaccaataattcaaagttttttattggtttaaatgatgtgtttttacaggtagt |
45655745 |
T |
|
| Q |
122 |
ttgtctctttgtgaacttgaggctgaacagataaaagaaattgatagttgtaagcacaagcatctctgtgat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45655744 |
ttgtctctttgtgaacttgaggctgaacagataaaagaaattgatagttgtaagcacaagcatctctgtgat |
45655673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University