View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_423 (Length: 211)
Name: NF10104A_low_423
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10104A_low_423 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 30 - 195
Target Start/End: Original strand, 1617138 - 1617306
Alignment:
Q |
30 |
tccttgcatgggtagatga---gggcaaagtaatcacacgttcaagtacaattttactttccactttcccccattttcatatctgaacatatcgtatatt |
126 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
1617138 |
tccttgcatgggtagatgatcagggcaaagtaatcacacttgcaagtacaattttattttccactttcccccattttcatatatgaacatatcgtatatt |
1617237 |
T |
 |
Q |
127 |
cgggaaggaaaatgttgaagtgcacgacannnnnnnnnngttaaaattgaacgaatcattcctctctgc |
195 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||| ||||||| |
|
|
T |
1617238 |
cgggaaggaaaatgttgaagtgcacgacaatttttttttgttaaaattgcacgaatcattcttctctgc |
1617306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University