View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_425 (Length: 210)
Name: NF10104A_low_425
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_425 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 12 - 195
Target Start/End: Complemental strand, 1796562 - 1796379
Alignment:
| Q |
12 |
ttactaacctgagaatgtgtgactggaagtaaacaaactgggtttggattctctttgaaaactcactcgcaaatttgtatttgttagcgttgttgttgaa |
111 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1796562 |
ttactaacctgagaatgtgtgattggaagtaaacaaactgggtttggattctctttgaaaactcactcgcaaatttgtattagttagcgttgttgttgaa |
1796463 |
T |
|
| Q |
112 |
aattcttatgcggctttttccgcttctctacgaaagggtttaagggtttacgactgtaacaaaacaattatttttctttttatt |
195 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1796462 |
aattcttatgcggctttttcctcttctctacgaaagggtttaagggtttacgactgtaacaaaacaattatttttctttttatt |
1796379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 70; Significance: 9e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 50 - 160
Target Start/End: Original strand, 2508900 - 2509006
Alignment:
| Q |
50 |
tgggtttggattctctttgaaaactcactcgcaaatttgtatttgttagcgttgttgttgaaaattcttatgcggctttttccgcttctctacgaaaggg |
149 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||| || | |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2508900 |
tgggtttggattctctttgaaaactcac----agatttgtatctgctgtcgttgttgttgaaaattcttatgcggctttttcctcttctctacgaaaggg |
2508995 |
T |
|
| Q |
150 |
tttaagggttt |
160 |
Q |
| |
|
||||||||||| |
|
|
| T |
2508996 |
tttaagggttt |
2509006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University