View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_431 (Length: 208)
Name: NF10104A_low_431
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_431 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 19 - 188
Target Start/End: Original strand, 20217515 - 20217685
Alignment:
| Q |
19 |
atagattgttagtatatagacatgtaatttgaattgagacaaaaatgaaaaataa-tggagtaatacatctgtacaaactgcaacgaaaaaaggtctatt |
117 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||| |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20217515 |
atagattgttagtatatagacaggtaatttgaattcagataaaaatgaaaaaaaaatggagtaatacatctgtacaaactgcaacgaaaaaaggtctatt |
20217614 |
T |
 |
| Q |
118 |
agattcaagtgtcatgcttggagtgacgctgcaattgactgatatttgatctggttgtattatagttatag |
188 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20217615 |
agattcaagtgtcatgattggagtcacgctgcaattgactgatgtttgatctggttgtattatagttatag |
20217685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University