View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_436 (Length: 206)
Name: NF10104A_low_436
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_436 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 21 - 176
Target Start/End: Original strand, 10559532 - 10559687
Alignment:
| Q |
21 |
gaacaatatagggcacttgtgtatggatgcaaaatcaaagtgcaaagaaaaaagtggtgcatgagagattgcaagtatcacaacaacaaactaggatgag |
120 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
10559532 |
gaacaatatagggcacttgcgtatggatgcaaaatcaaattgcaaaaaaaaaagtggtgcatgagcgattgcaagtatgacaacaacaaactaggatgag |
10559631 |
T |
 |
| Q |
121 |
tcaaaatgaatctaatatttgaaatttggcgtgtgaacgcgatcgccaacacgaaa |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10559632 |
tcaaaatgaatctaatatttgaaatttggcgtgtgaacgcgatcgccaacacgaaa |
10559687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University