View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_441 (Length: 204)
Name: NF10104A_low_441
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_441 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 23 - 184
Target Start/End: Original strand, 3006558 - 3006720
Alignment:
| Q |
23 |
attattcttcataacttgataaa-gaaaccattaattgcttcttatatggccatgagatacgatctccttgtaccttaaacacataactaattgtgctcc |
121 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3006558 |
attattcttcataacttgataaaagaaaccattaattgcttcttatatggccatgagatacgatctccttgtaccttaaacacataactaattgtgctcc |
3006657 |
T |
 |
| Q |
122 |
acctatcaattttatctccacactagtcaccatcagaatagccctactagattaagttgttca |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3006658 |
tcctatcaattttatctccacactagtcaccatcagaatagtcctactagattaagttgttca |
3006720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University