View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_443 (Length: 203)
Name: NF10104A_low_443
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_443 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 19 - 132
Target Start/End: Original strand, 32258913 - 32259026
Alignment:
| Q |
19 |
agaaattacctcttctacttcttcagcggctcttatgaagcttgaaatcaattttcttgcttttctaacatcttcttcagggtattccttcagccgcatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32258913 |
agaaattacctcttctacttcttcagcggctcttatgaagcttgaaatcaatttccttgcttttctaacatcttcttcagggtattccttcagccgcatg |
32259012 |
T |
|
| Q |
119 |
ccaacttcacgata |
132 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32259013 |
ccaacttcacgata |
32259026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University