View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10104A_low_443 (Length: 203)

Name: NF10104A_low_443
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10104A_low_443
NF10104A_low_443
[»] chr1 (1 HSPs)
chr1 (19-132)||(32258913-32259026)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 19 - 132
Target Start/End: Original strand, 32258913 - 32259026
Alignment:
19 agaaattacctcttctacttcttcagcggctcttatgaagcttgaaatcaattttcttgcttttctaacatcttcttcagggtattccttcagccgcatg 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
32258913 agaaattacctcttctacttcttcagcggctcttatgaagcttgaaatcaatttccttgcttttctaacatcttcttcagggtattccttcagccgcatg 32259012  T
119 ccaacttcacgata 132  Q
    ||||||||||||||    
32259013 ccaacttcacgata 32259026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University