View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_49 (Length: 406)
Name: NF10104A_low_49
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 243 - 388
Target Start/End: Original strand, 47162881 - 47163026
Alignment:
| Q |
243 |
ggcagtgcagaaaatttcatccaagttgtccatagttcattgattgaatttttcaatttcaaaattgaaaattaaccactggttcttccaataagggaag |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47162881 |
ggcagtgcagaaaatttcatccaagttgtccatagttcattggttgaatttttcaatttcaaaattgaaaattaaccactggttcttccaataagggaag |
47162980 |
T |
|
| Q |
343 |
gggccctcaattctttagtactagtcttcttttgtgatgagttgat |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47162981 |
gggccctcaattctttagtactagtcttcttttgtgatgagttgat |
47163026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 47162701 - 47162803
Alignment:
| Q |
1 |
gactcttcaagaaaaactgttttcgttcccctttccttttatgcctattttaagctcaaattcaagttaaagtctcttttgttttctttttggttacact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
47162701 |
gactcttcaagaaaaactgttttcgttcccctttccttttatgcctattttaagctcaaattcaagtttaagtctcttttgttttctttttggttacatt |
47162800 |
T |
|
| Q |
101 |
gag |
103 |
Q |
| |
|
||| |
|
|
| T |
47162801 |
gag |
47162803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University