View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_76 (Length: 362)
Name: NF10104A_low_76
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_76 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 82 - 348
Target Start/End: Original strand, 47161707 - 47161971
Alignment:
| Q |
82 |
atcatcgcattggactttgaacaatcacttaagcgaacacgtcacattttgactcaaaacattaacacgttcaattaatggactctctcaccaatttatg |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
47161707 |
atcatcgcattggactttgaacaatcacttaagtgaacacgtcacattttgactcaaaacattaacacgttcaattaatggactct--caccaattcatg |
47161804 |
T |
 |
| Q |
182 |
gactttacaaattaattcaccaatgtagaattattaagactaggtcccaaatgcggttacagataactcaaatgtgatcaattattggaacattataaag |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47161805 |
gactttacaaattaattcaccaatgtagaattattaagactaggtcccaaatgcggttacagataactcaaatgtgatcaattattggaacattataaag |
47161904 |
T |
 |
| Q |
282 |
ttgagtgtgaagaataccatctttcaccatcaacaaggccatttgagattgagaataagattcacaa |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47161905 |
ttgagtgtgaagaataccatctttcaccatcaacaaggccatttgagattgagaataagattcacaa |
47161971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University