View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104A_low_8 (Length: 521)
Name: NF10104A_low_8
Description: NF10104A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104A_low_8 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 430; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 430; E-Value: 0
Query Start/End: Original strand, 21 - 521
Target Start/End: Complemental strand, 36166948 - 36166448
Alignment:
| Q |
21 |
cattatgggaggggattactcgctttaggttcttcctagggatgtcttggaccattgctcttaggcgttgaaggaaggagatggtgattggggaccgaag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36166948 |
cattatgggaggggattactcgctttaggttcttcctagggatgtcttgggccattgctcttaggtgttgaaggaaggagatggtgattggggaccgaag |
36166849 |
T |
 |
| Q |
121 |
ccatttagatttaataatcattagttgaataatagaaatttcaaaaggggtggaggaggaggcttgggaagagtttcaagtgattgggtagatgagtttt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
36166848 |
ccatttagatttaataatcattagttgaataatagaaatttcaaaaggg-tggaggaggaggcttgggaagagtttcaagtgatcgggtggatgagtttt |
36166750 |
T |
 |
| Q |
221 |
gtgttgaaagaaaaattaaagagattcaaaggagtgattaaagagtggaataaggtggaatatgggaagttggaggataggctagtgttgcttatggagg |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
36166749 |
gtgttgaaagaaaaattaaagagattcaaaggagtgattaaagagtggaataaggtggaatatgagaagttggaggatatgctagtgttgcttatggagg |
36166650 |
T |
 |
| Q |
321 |
aaattgcaaagttgtgagaagggagggagggagtttaacgcatgaggaggtggaggtgaggaaaattaaatttggggagctatggagacttttgagaagt |
420 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36166649 |
aaattgcaaagttgtgagaggggagggagggattttaacgcatgcggaggtggaggtgaggaaaattaaatttggggagctatggagacttttgagaagt |
36166550 |
T |
 |
| Q |
421 |
aaagatggtttgttagttcaacgatctaagtctaaatggcttaaaggaacggatgcaaactctaaa-ctttttcataattgtattaaaactagaaataga |
519 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
36166549 |
aaatatggtttgttagttcaacgatctaagtctaaatggcttaaaggaacgaatgcaaactctaaatttttttcataattgtattaaagatagaaataga |
36166450 |
T |
 |
| Q |
520 |
ag |
521 |
Q |
| |
|
|| |
|
|
| T |
36166449 |
ag |
36166448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University