View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104_low_14 (Length: 374)
Name: NF10104_low_14
Description: NF10104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 156 - 359
Target Start/End: Complemental strand, 1418744 - 1418562
Alignment:
| Q |
156 |
caatttttagcttttaaacaattcaagtcggttcaacaattcatcaaatatgaaccgattccgaacattatattatactaccttttaaacaattcatata |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
1418744 |
caatttttagcttttaaacaattcaagtcggttcaacaattcatcaaatatgaaccggttccgaacattatattata---------------------ta |
1418666 |
T |
|
| Q |
256 |
catacgtaaatggatctcttttataaacaacaaattactatctttcaaacaaagattaaagttcagtataacataacatcatatataaatacacgacaat |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1418665 |
gatacgtaaatggatctcttttataaacaacaaattactatctttgaaacaaagattaaagttcagtataacataacatcatatataaatacacgacaat |
1418566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 11 - 73
Target Start/End: Complemental strand, 1418955 - 1418893
Alignment:
| Q |
11 |
gatgaatatagtcagtcatatggtgtcaaaggcaatgtgcattgtgaaagaaatacctaaaat |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1418955 |
gatgaatatagtcagtcatatggtgtcaaaggcaatgtgcattgtgaaagaaagacctaaaat |
1418893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University