View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10104_low_27 (Length: 292)

Name: NF10104_low_27
Description: NF10104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10104_low_27
NF10104_low_27
[»] chr8 (2 HSPs)
chr8 (148-292)||(32927480-32927623)
chr8 (11-71)||(32927689-32927749)


Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 148 - 292
Target Start/End: Complemental strand, 32927623 - 32927480
Alignment:
Q  148 tgaattgaactaaagcagaccgtgaagccaaattgaattggacccaaagcagcaataagaacacaaaatagaaccgaaactgaatcccgcataaccgaag 247  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  32927623 tgaattgaactaaa-cagaccgtgaagccaaattgaattggacccaaagcagcaataagaacacaaaatagaaccgaaactgaatcccgcataacagaag 32927525  T
Q  248 tagttgaacccataacactagattgtcttgaacccattttatacc 292  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  32927524 tagttgaacccataacactagattgtcttgaacccattttatacc 32927480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 11 - 71
Target Start/End: Complemental strand, 32927749 - 32927689
Alignment:
Q  11 cagagagcttgagatcattgattatagcttgttgcgtcggagaagaatatccacactttcc 71  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32927749 cagagagcttgagatcattgattatagcttgttgcgtcggagaagaatatccacactttcc 32927689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University