View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104_low_36 (Length: 250)
Name: NF10104_low_36
Description: NF10104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 22124194 - 22123956
Alignment:
| Q |
1 |
agaagattgtatccagttatatgaaagaaaaaacacaccttaattttcctgaagtaggattgagatttcaacttcatgagtgtcgaaagacatctccatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22124194 |
agaagattgtatccagttatatgaaagaaaaaacacaccttaattttcctgaagtaggattgagatttcaacttcatgagtgtcgaaagacatctccatc |
22124095 |
T |
|
| Q |
101 |
aatttctacagggggaacatgctcgacgacagccatcccatgcacaaatctagcattcatatcccaaatgctgagaacttgaagcttctctaagttctga |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22124094 |
gatttctacaaggggaacatgctcgacgacagccatcccatgcacaaatctagcatgcatatcccaaatgctgagaacttgatgcttctctaagttctga |
22123995 |
T |
|
| Q |
201 |
attccagtggggaccctctccagttggggaatacttcat |
239 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22123994 |
attccagtggagaccctctccagttggggaatacttcat |
22123956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University