View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104_low_42 (Length: 240)
Name: NF10104_low_42
Description: NF10104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 28118985 - 28119204
Alignment:
| Q |
1 |
cttcatagatcatatgactctcacaaatttaatcaaaccctagnnnnnnnaaacctaattattacatctnnnnnnnnnccatagctatagacattnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28118985 |
cttcatagatcatatgactctcacaaatttaatcaaaccctagtttttttaaacctaattattacatctaaaaaaaa-ccatagctatagacattaaaac |
28119083 |
T |
|
| Q |
101 |
nnnnnnnnnnntattaattaccctttagagatgagtctaaactctagtggcagcggaagcagtggtggcggcggaagcagtggaagcccttgtggggctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28119084 |
aaaaacaaaaatattaattaccctttagagatgagtctaaactctagtggcagcggaagcggtggtggcggcggaagcagtggaagcccttgtggggctt |
28119183 |
T |
|
| Q |
201 |
gcaagtttttgaggaggaagt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28119184 |
gcaagtttttgaggaggaagt |
28119204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University