View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104_low_43 (Length: 239)
Name: NF10104_low_43
Description: NF10104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 22124365 - 22124583
Alignment:
| Q |
1 |
tcaagtgcaatgacaattccgattctccaaagggacgtcggcacttccattactctgtaaaaaagaatgttttatctttcttattattttggtttggatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22124365 |
tcaagtgcaatgacaattccgattctccaaagggacgtcagcacttccattactctataaaaaagaatgttttgtctttcttattattttggtttggatt |
22124464 |
T |
 |
| Q |
101 |
tgatatttgagttgtatgtaatgtattatgtatgcaacatcatgttatgaaagcttccctatcaagaattttaagaccttgtttttactttgacnnnnnn |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22124465 |
tgatatttgagttgtgtgtaatgtattatgtatgcaacatcatgttatgaaagcttccctatcaagaattttaagaccttgtttttactttgacttcttt |
22124564 |
T |
 |
| Q |
201 |
nctattttggaataagaaa |
219 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
22124565 |
tctattttggaataagaaa |
22124583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University