View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104_low_45 (Length: 238)
Name: NF10104_low_45
Description: NF10104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 17 - 222
Target Start/End: Complemental strand, 4681034 - 4680819
Alignment:
| Q |
17 |
actaattatattgcataatcgatcataagatta-----aaatttgtattaattataagaggtacaacttgtttggtggttcctcacgtctctttta---- |
107 |
Q |
| |
|
||||||||||||||||||| ||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4681034 |
actaattatattgcataattgatcataagataagataaaaatttgtattaattataagaggtacaacttgtttggtggttcctcacgtctcttttaattt |
4680935 |
T |
 |
| Q |
108 |
-ttcagttatgaaattggatgatgctggattcatacggagtccctttctttttcttgaatatttacctctttcagctttgttcgtgcaagtcatcgcaaa |
206 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4680934 |
atttagttatgaaattggatgatgctggattcatacggagtccctttctttttcttgaatatttacctctttcagctttgttcgtgcaagtcatcgcaaa |
4680835 |
T |
 |
| Q |
207 |
ttgttgtcaaatacct |
222 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4680834 |
ttgttgtcaaatacct |
4680819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University