View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104_low_46 (Length: 237)
Name: NF10104_low_46
Description: NF10104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10104_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 32927435 - 32927200
Alignment:
Q |
1 |
ccactctcttctctgaaactcatcttcttaacccaaaaggtgtttgtgaaaatgtctcagagaagatttttggaacgtgatgttgctgagctgtgtaata |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32927435 |
ccactctcttctctgaaactcatcttcttaacccaaaaggtgtttgtgaaaatgtctcagagaagatttttggaacgtgatgttgctgagctgtgtaata |
32927336 |
T |
 |
Q |
101 |
gaagaagagtgagttaa-------------taattgtgaaaggttggtttcattgttgttcttatcatgtggtgttgcgtcaatgtgtagtcatcatcat |
187 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32927335 |
gaagaagagtgagttaataataatggaaaataattgtgaaaggttggttacattgttgttcttatcatgtggtgttgcgtcaatgtgtagtcatcatcat |
32927236 |
T |
 |
Q |
188 |
tttgatatatactattattattcatgtgttatgttt |
223 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
32927235 |
tttgatatatactattattattcatgtgttatgttt |
32927200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University