View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104_low_48 (Length: 236)
Name: NF10104_low_48
Description: NF10104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104_low_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 220
Target Start/End: Complemental strand, 36942818 - 36942612
Alignment:
| Q |
14 |
caaaggttgaactcaactgataatccatttgttgctgtggagtttgatatctatcggaatcattgggatccacctcttgaacatgccggaatcgacatca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36942818 |
caaaggttgaactcaactgataatccatttgttgctgtggagtttgatatctatcggaatcattgggatccacctcttgaacatgccggaatcgacatca |
36942719 |
T |
|
| Q |
114 |
actccatgctgtctgttgctaatgttacatggttggctgatatcaaacaaggcagactcaatgaggcttggatcaattacaatgctagttcattaaatct |
213 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36942718 |
actctatgctgtctgttgctaatgttacatggttggctgatatcaaacaaggtagactcaatgaggcttggatcaattacaatgctagttcattaaatct |
36942619 |
T |
|
| Q |
214 |
aagtgtt |
220 |
Q |
| |
|
||||||| |
|
|
| T |
36942618 |
aagtgtt |
36942612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University