View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104_low_50 (Length: 226)
Name: NF10104_low_50
Description: NF10104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104_low_50 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 26 - 226
Target Start/End: Original strand, 20427047 - 20427239
Alignment:
| Q |
26 |
caagtagcttcaaattcgggaaggtctttccattgaatgaggacctcagcaacaccatc----agtagtgttgcgtacagctttgacatcagcagggaca |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
20427047 |
caagtagcttcaaattcgggaaggtctttccattgaatgaggacctcagcaacaccatccatcagtagtgttgcgtacagc------------agggaca |
20427134 |
T |
|
| Q |
122 |
acttgtaattccatgtcttcagagagcattggcggaagtggttgtggatttgttgagggagaaatagctttcttcagtaaagatgcatggaaaactgggt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20427135 |
acttgtaattccatgtcttcagagagcattggcggaagtggttgtggatttgttgagggagaaatagctttcttcagtaaagatgcatggaaaactgggt |
20427234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University