View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104_low_52 (Length: 211)
Name: NF10104_low_52
Description: NF10104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104_low_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 69 - 197
Target Start/End: Original strand, 33067088 - 33067216
Alignment:
| Q |
69 |
ctatggatctgtctaatctaattccattatcaaacagttgtaggttcaatacaaagctttggagtttgaacttgaatctgttgaacctgtaaacttctca |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33067088 |
ctatggatctgtctaatctaattccattatcaaacagttgtaggttcaatacaaagctttggagtttgaacttgaatctgttgaacctgtaaacttctca |
33067187 |
T |
 |
| Q |
169 |
atggagccaaacttgaacctgatcttctt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33067188 |
atggagccaaacttgaacctgatcttctt |
33067216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University