View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104_low_53 (Length: 206)
Name: NF10104_low_53
Description: NF10104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10104_low_53 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 20 - 161
Target Start/End: Original strand, 12045067 - 12045208
Alignment:
Q |
20 |
tacaacttgggaggaggttgataaaggtgtaaatcacttccaccgtgacggaataacgctattgtgctttttggttgagatctaggttggtgtcactcac |
119 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12045067 |
tacaacttgggaggaggttgataaaggtgtaaatcacttccaccgtgacggaataacgctattgtgctttttggttgagatctaggttggtgtcactcac |
12045166 |
T |
 |
Q |
120 |
aacatttgttctattaatttttattttggtgatatttgtcca |
161 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
12045167 |
aacatttgttctattaatttttattttggcgatatttgtcca |
12045208 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University