View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10104_low_8 (Length: 425)
Name: NF10104_low_8
Description: NF10104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10104_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 366; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 366; E-Value: 0
Query Start/End: Original strand, 19 - 420
Target Start/End: Complemental strand, 5053986 - 5053585
Alignment:
| Q |
19 |
ttttctgcaagcgcaattgcgatgatataaaagattttgaagtctctccaatagtatcagtaaccactattgcaactgcagtatcaaggattttgaagtc |
118 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5053986 |
ttttctgcaagcgcaattgccaccatataaaagattttgaagtctctccaatagtatcagtaaccactattgcaactgcagtatcaaggattttgaagtc |
5053887 |
T |
|
| Q |
119 |
tccgcaacagtattgccacggtaatataagggattttgaagcctccgcaacagtattgccactgtaatataagggattttaaagtctccacaacagtatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5053886 |
tccgcaacagtattgccacggtaatataagggattttgaagcctccacaacagtattgccactgtaatataagggattttaaagtctccacaacagtatt |
5053787 |
T |
|
| Q |
219 |
gcaaccgcaattttgacatcttattcctgcatttttctgcaatataaaggtttgcaacataactagaaccactatatataatctatagttggtagtatta |
318 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5053786 |
gcaaccgcaattttgacatcttattcccgcatttttctgcaatataaaggtttgcaacgtaactagaaccactatatataatctatagttggtagtatta |
5053687 |
T |
|
| Q |
319 |
gttttgtcaccgtcaagggacaatagtagttgtatagttttcagaaattgattcaaattctgtgatgcaaacaagtgaaatgagcgctttttctgtgctg |
418 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5053686 |
gttttgccaccgtcgagggacaatagtagttgtatagttttcagaaattgattcaaattctgtgatgctaacaagtgaaatgagcgctttttctgtgctg |
5053587 |
T |
|
| Q |
419 |
ct |
420 |
Q |
| |
|
|| |
|
|
| T |
5053586 |
ct |
5053585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University