View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10105_low_3 (Length: 450)
Name: NF10105_low_3
Description: NF10105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10105_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 6e-81; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 167 - 323
Target Start/End: Original strand, 6976585 - 6976741
Alignment:
| Q |
167 |
atgtaggttggatatcgtcatatagattgtgctcaatattatggcaatgaaaaggaggtgaggtgttatgtatcattagtcctatcaatgtcaatatcgt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6976585 |
atgtaggttggatatcgtcatatagattgtgctcaatattatggcaatgaaaaggaggtgaggtgttatgtatcattagtcctatcaatgtcaatatcgt |
6976684 |
T |
 |
| Q |
267 |
gtctgatgtccgtgtttgtgtccatgcttcatagaatacatctgtccatcatctttt |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6976685 |
gtctgatgtccgtgtttgtgtccatgcttcatagaatacatctgtccatcatgtttt |
6976741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 367 - 450
Target Start/End: Original strand, 6976735 - 6976807
Alignment:
| Q |
367 |
atgttttagtaaagaaatattattcagtatgttgattgcagaatttgaatttgaaattgttacagttttgaattttgatactct |
450 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6976735 |
atgttttagtaaagaaatattattcagta-----------gaatttgaatttgaaattgttacagttttgaattttgatactct |
6976807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 171 - 225
Target Start/End: Original strand, 6957129 - 6957183
Alignment:
| Q |
171 |
aggttggatatcgtcatatagattgtgctcaatattatggcaatgaaaaggaggt |
225 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6957129 |
aggttggttatcgtcatatagattgtgctcaaatttatggcaatgaaaaggaggt |
6957183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 273 - 301
Target Start/End: Original strand, 6301467 - 6301495
Alignment:
| Q |
273 |
tgtccgtgtttgtgtccatgcttcataga |
301 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6301467 |
tgtccgtgtttgtgtccatgcttcataga |
6301495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University