View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10105_low_7 (Length: 259)
Name: NF10105_low_7
Description: NF10105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10105_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 2 - 241
Target Start/End: Complemental strand, 4063581 - 4063342
Alignment:
| Q |
2 |
tctgcatcatttgactatttccatagggcctaatttgtttgttgtaatcctccatggaaattaagcaaggaaggagattgaagggttttgtctcactctt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4063581 |
tctgcatcatttgactatttccatagggtctaatttgtttgttataatcctccatggaaattaagcaaggaaggagattgaagggttttgtctcactctt |
4063482 |
T |
|
| Q |
102 |
caaaggtcaagcctcttttttctatttatcaagagagatgatcaaatattttagagaaagtgggacagtgtggggtgatccaaccaagactttggagctg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4063481 |
caaaggtcaagcctcttttttctatttatcaagagagatgatcaaatattttagagaaagtgggacagtgtggggtgatccaaccaagactttggagctg |
4063382 |
T |
|
| Q |
202 |
gcttagtttactttgatttctcaaatgctactatctctct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4063381 |
gcttagtttactttgatttctcaaatgctactatctctct |
4063342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University