View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10106_low_11 (Length: 244)
Name: NF10106_low_11
Description: NF10106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10106_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 13 - 227
Target Start/End: Complemental strand, 26608457 - 26608241
Alignment:
| Q |
13 |
cagattgattgaaacacaatcctactcgtgaacttggaacctattttgatcttccgtctcaccacgccatcttgacgctcccttctgcagcactgtttcg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26608457 |
cagattgattgaaacacaatcctactcgtgaacttggaacctattttgatcttccgtctcaccacgccatcttgacgctcccttctgctgcactgtttcg |
26608358 |
T |
|
| Q |
113 |
ccacttcgtcctgcaatgcaatcttgcgcatcattgactaattgaaacacaaccc--gttttttcacccaactagctgtgtcgtcttgcctcacagcctt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26608357 |
ccacttcgtcctgcaatgcaatcttgcgcatcattgactaattgaaacacaacccctgttttttcacccaactagctgtgtcgtcttgcctcacagcctt |
26608258 |
T |
|
| Q |
211 |
ccgttggtcgtgccatc |
227 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
26608257 |
ccgttggtcgtgccatc |
26608241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University