View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10106_low_12 (Length: 240)
Name: NF10106_low_12
Description: NF10106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10106_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 5173670 - 5173892
Alignment:
| Q |
1 |
ttgtttaatgacacggttaacaacaatgacatttagttaagtgattaagttggtccttgattttatcattcgctctnnnnnnntgattttgactattaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5173670 |
ttgtttaatgacacggttaacaacaatgacatttagttaagtgattaagttggtccttgattttatcattcgctctaaaaaa-tgattttgactattaac |
5173768 |
T |
 |
| Q |
101 |
attgcaaaaactattcccgactctgtcaatcgttataattgaggggttacgaggttgttgttgaacttagaatgatattgttgaactttgaaggggttgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
5173769 |
attgcaaaaactattcccgactctgtcaaacgttataattgaggggttacgaggttgttgttgaacttagaatgatgttgttgaactttgaaggggtcgc |
5173868 |
T |
 |
| Q |
201 |
agttgaacttaaaatgctaaggtt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5173869 |
agttgaacttaaaatgctaaggtt |
5173892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University