View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10106_low_15 (Length: 227)
Name: NF10106_low_15
Description: NF10106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10106_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 5173263 - 5173440
Alignment:
| Q |
1 |
gtgtctaccatgtgaggtggggatgatttcattagagaatctagtaaaagctacagagaatgctttttattttgtcgtcatttaattttgtgaagtcccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173263 |
gtgtctaccatgtgaggtggggatgatttcatttgagaatctagtaaaagcaacagagaatgctttttattttgtcgtcatttaattttgtgaagtcccc |
5173362 |
T |
|
| Q |
101 |
ctcgtcgtacatatatagatccgcgccgattcatatataattttatagggtttctgtcctaatgatatataccctccg |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
5173363 |
ctcgtcgtacatatatagatccgcgccgattcatatataattttatagggtttctgtcgtaatgatatatacgctccg |
5173440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University