View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10106_low_17 (Length: 215)
Name: NF10106_low_17
Description: NF10106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10106_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 19280513 - 19280695
Alignment:
Q |
18 |
agggcggggctgcaggcatcattaggagataatgaattgagagtgatcgtagacggatatctttatcattacgacgagcttttccgattgaaggaggtgg |
117 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19280513 |
agggcggggctgcaggcatcattgggagataatgaattgagagtgatcgtagacggatatctttatcattacgacgagcttttccgattgaaggaggtgg |
19280612 |
T |
 |
Q |
118 |
ctgttaaatcagatgtttttcaccttattaaaggcatttgggcttcacctgctgagagacccttcatttggataggtggtttc |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19280613 |
ctgttaaatcagatgtttttcaccttattaaaggcatttgggcttcacctgctgagagacccttcatttggataggtggtttc |
19280695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University