View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10106_low_2 (Length: 381)
Name: NF10106_low_2
Description: NF10106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10106_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 109 - 375
Target Start/End: Original strand, 37196620 - 37196886
Alignment:
| Q |
109 |
tatctatcaaatttgttgggtccaaaaatacacatttcctcactcaaatggcctctgtacgtttgtttttgttagctattttgatcattgtctcactttc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37196620 |
tatctatcaaatttgttgggtccaaaaatacacatttcctcactcaaatggcctctgtccgtttgtttttgttagctattttgatcattgtgtcactttc |
37196719 |
T |
|
| Q |
209 |
cagcattgacaatgtccaaggtggtgggactagaaaacttttgacacaaacatttcctgatttgggcaaaattccagggctagagtttcctcctttccca |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37196720 |
cagcattgacaatgtccaaggtggtgggactagaaaacttttgacacaaacatttcctgatttgggcaaaattccagggctagagtttcctcctttccca |
37196819 |
T |
|
| Q |
309 |
ccagtgactgaatggccagagtacaggttgcctccacccattttcaatattcctgacttcttctctc |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37196820 |
ccagtgactgaatggccagagtacaggttgcctccacccattttcaatattcctgacttcttctctc |
37196886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 23 - 117
Target Start/End: Original strand, 37196504 - 37196598
Alignment:
| Q |
23 |
acgaatatggtttaagttgtactataaaaacacaagaaccaactcttatgttgtcacttgtcttcactcttctcccttactgcaattatctatca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37196504 |
acgaatatggtttaagttgtactataaaaacacaagaaccaactcttatgttgtcacttgtcttcactcttctcccttactacaattatctatca |
37196598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University