View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10106_low_4 (Length: 363)
Name: NF10106_low_4
Description: NF10106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10106_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 301; Significance: 1e-169; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 11 - 347
Target Start/End: Complemental strand, 32551761 - 32551425
Alignment:
| Q |
11 |
gagatgaatacacaatctctcaagtttctatagctttatcgcttttctgttatggtatatagagctttctagttccatttctacggcttccgagtctgat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32551761 |
gagatgaatacacaatctctcaagtttctatagctttatcgcttttctgttatggtatatagagctttctagttccatttctacggcttccgagtctgat |
32551662 |
T |
 |
| Q |
111 |
tcttctcaaacaccatcaccggtgcctccacctgtgccaactccatcatcgctagttactttttgtacttcaaagaatgttttcaagacgtctgtacaac |
210 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |||| |
|
|
| T |
32551661 |
tcttctcaaacaccatcaccgttgcctccacctgtgccaactccatcatcgctagttactttttgtacttcaaagaacgttttcaagacgtccgtgcaac |
32551562 |
T |
 |
| Q |
211 |
aaatcacgctgttcgctgtgttcatgcaaccgcaattgcatcacactgcaattgaggtctgatcttcaatcacgggtatgaacttttgcaacgacaccag |
310 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32551561 |
aaattacgttgttcgctgtgttcatgcaaccgcaattgcatcacactgcaattgaggtctgatcttcaatcacgggtatgaacttttgcaacgacaccag |
32551462 |
T |
 |
| Q |
311 |
ctatggcatcagaccatggtaacagtcgcaccaatat |
347 |
Q |
| |
|
|||| |||||||||||| ||||||||| ||||||||| |
|
|
| T |
32551461 |
ctatcgcatcagaccattgtaacagtcacaccaatat |
32551425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 240 - 324
Target Start/End: Original strand, 40577320 - 40577404
Alignment:
| Q |
240 |
ccgcaattgcatcacactgcaattgaggtctgatcttcaatcacgggtatgaacttttgcaacgacaccagctatggcatcagac |
324 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||| |||||| ||| ||||| ||||||||| |
|
|
| T |
40577320 |
ccgcaattgcatcacactgcaattgcggtctgatcttcaatcacgtgtacgaactttcgcaacggcactagctaccgcatcagac |
40577404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University