View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10106_low_7 (Length: 294)
Name: NF10106_low_7
Description: NF10106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10106_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 283
Target Start/End: Original strand, 41095455 - 41095720
Alignment:
Q |
19 |
ttgttgccactaatgctagtaatacatccaagttggatgcacccaacctagtttctggcattacatcgatcgagataactttgaacaagatccacacatc |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
41095455 |
ttgttgccactaatgctagtaatacatccaagttggatgcacccaacctagtttctggcattacatcgatcgagataactttgagcaagatccacacatc |
41095554 |
T |
 |
Q |
119 |
gttgcatatatgaaatgttggtcttcacatgataatcacaccacaatcatgtgtaaatcatatagaatgaccataataaactttcgatcaacatataact |
218 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
41095555 |
gttgcatatatgaaatgttggtcttcacgtgataatcacaccacaatca--tgtaaatcatatagaatgaccataataaacgttcgatcaacatataact |
41095652 |
T |
 |
Q |
219 |
tgttattgtccctc---nnnnnnnnntataacttgtttattaatttaccaacttttattaacattcat |
283 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41095653 |
tgttattgtccctcaaaaaaaaaaaatataacttgtttattaatttaccaacttttattaacattcat |
41095720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University