View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10107_high_22 (Length: 246)
Name: NF10107_high_22
Description: NF10107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10107_high_22 |
 |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0223 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 21645 - 21880
Alignment:
| Q |
1 |
ctgataataccttatgccctatggtaggtgctgtccctcaatgtgtnnnnnnnnnntcccttccctataaccttagaaatgaaatctcaaaaaagcattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21645 |
ctgataataccttatgccctatggtaggtgctgtcccttaatgtgtccccccc---tcccttccctatagccttagaaatgaaatctcaaaaaagcattt |
21741 |
T |
 |
| Q |
101 |
aactttttcagaggtgaaaatcacggggaggtttctgatattgtatatgattgtgccctatgcaccaatatataggtgcttttaagtgtctttcgttgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21742 |
aactttttcagaggtgaaaatcacggggaggtttctgatattgtatatgattgtgccctatgcaccaatatataggtgcttttaagtgtctttcgttgtt |
21841 |
T |
 |
| Q |
201 |
accattatacaaactgtcaaagtttgacctttgcttctc |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21842 |
accattatacaaactgtcaaagtttgacctttgtttctc |
21880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University