View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10107_high_27 (Length: 237)
Name: NF10107_high_27
Description: NF10107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10107_high_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 34 - 187
Target Start/End: Original strand, 9621141 - 9621298
Alignment:
| Q |
34 |
atgatagtcattaaaatagatattttctttt---ttatgagtggagtgaacatcaataacaaaatgagcactaaaattgttaagaatatattatgatcac |
130 |
Q |
| |
|
||||||||||| ||||||||||||| |||| ||||||||||| |||| ||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
9621141 |
atgatagtcatccaaatagatattttttttttttttatgagtggaatgaatatcaataacaaaaagatcactaaaattgttaagaatatattatgatcac |
9621240 |
T |
|
| Q |
131 |
tccccat-nnnnnnnttatccttatttgtgaagacatgcatggatgaaatgttcatat |
187 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9621241 |
tccccataaaaaaaattctccttatttgtgaagacatgcatggatgaaatgtccatat |
9621298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University