View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10107_high_27 (Length: 237)

Name: NF10107_high_27
Description: NF10107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10107_high_27
NF10107_high_27
[»] chr1 (1 HSPs)
chr1 (34-187)||(9621141-9621298)


Alignment Details
Target: chr1 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 34 - 187
Target Start/End: Original strand, 9621141 - 9621298
Alignment:
34 atgatagtcattaaaatagatattttctttt---ttatgagtggagtgaacatcaataacaaaatgagcactaaaattgttaagaatatattatgatcac 130  Q
    |||||||||||  ||||||||||||| ||||   ||||||||||| |||| ||||||||||||| || ||||||||||||||||||||||||||||||||    
9621141 atgatagtcatccaaatagatattttttttttttttatgagtggaatgaatatcaataacaaaaagatcactaaaattgttaagaatatattatgatcac 9621240  T
131 tccccat-nnnnnnnttatccttatttgtgaagacatgcatggatgaaatgttcatat 187  Q
    |||||||        || |||||||||||||||||||||||||||||||||| |||||    
9621241 tccccataaaaaaaattctccttatttgtgaagacatgcatggatgaaatgtccatat 9621298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University