View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10107_low_10 (Length: 369)
Name: NF10107_low_10
Description: NF10107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10107_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 2e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 48138773 - 48138520
Alignment:
| Q |
1 |
caatgttaataattagttgttactaatattatcttttttaacaataaaagttctccaactcctttggctataggcgaagttagaagaatgaccagcatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48138773 |
caatgttaataattagttgttactaatattatcttttttatcaataaaagttctccaactcctttggctataggcgaagttagaagaatgaccagcatag |
48138674 |
T |
|
| Q |
101 |
gtcatggtcatcccaaattaattttattttctatttacattggtatggtannnnnnnnnngtctttatatcttattgtaaacttcatatgatattgtata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48138673 |
gtcatggtcatcccaaattaattttattttctatttacattggtttgtta-tttttttttgtctttatatcttattgtaaacttcatatgatattgtata |
48138575 |
T |
|
| Q |
201 |
ataggctc-nnnnnnnactcaatatattcagccttaatacttaagttttcactat |
254 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48138574 |
ataggctcttttttttactcaatatattcagccttaatacttaagttttcactat |
48138520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University