View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10107_low_11 (Length: 369)
Name: NF10107_low_11
Description: NF10107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10107_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 19 - 356
Target Start/End: Complemental strand, 24514386 - 24514045
Alignment:
| Q |
19 |
tgatattcacgagaatccattattttggcacatcacttcattttcgaaattgatagtgtgacatagaaaattgacggcttcttatcagaaatcggtataa |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
24514386 |
tgatattcacgagaatccattatttttgcacatcacttcattttcgaaattgatagtgtgacatagaaaattgacgacttcttatcagaaatcggtgtaa |
24514287 |
T |
 |
| Q |
119 |
nnnnnnnn--acaatgctaatatatatgccatcaaattcttgaaaatacgatannnnnnn-agaagatttgccaattatattactcgagttgtaacnnnn |
215 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
24514286 |
atttttttttacaatgctaatatatatgctatcaaattcttgaaaatacgatattttttttataagatttgccaattatattactcgagttgtaactttt |
24514187 |
T |
 |
| Q |
216 |
nnn-attttatttctgtgatgtgtcatagtaaatggcaagcattcaaattggcatctctttctggcttggctgagcccctaggggttattattgtaggta |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24514186 |
ttttattttatttctgtgatgtgtcatagtaaatggcaagcattcaaattggcatctctttctggcttggctgagcccctaggggttattattgtaggta |
24514087 |
T |
 |
| Q |
315 |
atatcctctgcttttgctgctttgtaccatattaacgcatct |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24514086 |
atatcctctgcttttgctgctttgtaccatattaacgcatct |
24514045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University