View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10107_low_16 (Length: 304)
Name: NF10107_low_16
Description: NF10107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10107_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 17 - 276
Target Start/End: Original strand, 10470381 - 10470640
Alignment:
| Q |
17 |
agtagtgatattcacaatgtatggcaaggagctgcagattttcttctgcagaattttgcagtaaatgggctggttgtaggtgctttgaggtaatgccatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10470381 |
agtagtgatattcacaatgtatggcaaggagctgcagattttcttctgcagaattttgcagtaaatgggctggttgtaggtgctttgaggtaatgccatg |
10470480 |
T |
|
| Q |
117 |
ttgtgggttgggagtgattttcttctgaacaataaatttttagtcttgttataggtgctgtctaaaactaggaagctttgttttggcatgcttaagtgtt |
216 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10470481 |
ttgtgggttgggagtgattttctgctgaacaataaagttttagtcttgttataggtgctgtctaaaactaggaagctttgttttggcatgcttaagtgtt |
10470580 |
T |
|
| Q |
217 |
caaggatgatgttggagcttaggaagctttgtgtattagaggtttagattgcttttggtg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10470581 |
caaggatgatgttggagcttaggaagctttgtgtattagaggtttagattgtttttggtg |
10470640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 115 - 264
Target Start/End: Original strand, 42721366 - 42721507
Alignment:
| Q |
115 |
tgttgtgggttgggagtgattttcttctgaacaataaatttttagtcttgttataggtgctgtctaaaactaggaagctttgttttggcatgcttaagtg |
214 |
Q |
| |
|
|||||||||| ||||||||| || | || ||||| |||||||| | |||||||||| ||||| ||||||||||| ||||||||| ||| || |
|
|
| T |
42721366 |
tgttgtgggtcgggagtgatcttgtattgtacaatcaatttttaattttgttataggggctgtaaaaaactaggaaactttgttttagca--------tg |
42721457 |
T |
|
| Q |
215 |
ttcaaggatgatgttggagcttaggaagctttgtgtattagaggtttaga |
264 |
Q |
| |
|
| || ||||||||||||| |||||||||| ||||||||| | |||||||| |
|
|
| T |
42721458 |
tgcagggatgatgttggaccttaggaagccttgtgtatttgtggtttaga |
42721507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University