View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10107_low_18 (Length: 296)
Name: NF10107_low_18
Description: NF10107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10107_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 19 - 283
Target Start/End: Original strand, 7404518 - 7404782
Alignment:
| Q |
19 |
cataatttcgacgtaaccatcttcgtcgtcacaaccgccacctcagattcagacaaaacaaaatcacatatacttcaacaaatatcaaaccctaatagcc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7404518 |
cataatttcgacgtaaccatcttcgtcgtcacaaccgccacctcagattcagacaaaacaaaatcacatatacttcaacaaatatcaaaccttaatagcc |
7404617 |
T |
 |
| Q |
119 |
tcgacatcattgtaacacctcctgtcgatgtctccgacaaacttgacccaaacaatccatccttaggattacaaattgttttaacaatgattgaatctct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7404618 |
tcgacatcattgtaacacctcctgtcgatgtctccgacaaacttgacccaaacaatccatccttaggattacaaattgttttaacaatgattgaatctct |
7404717 |
T |
 |
| Q |
219 |
tccttttattcgctctgaaatccaatccatgaagaatcctccatctgttcttatcgtggatatct |
283 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7404718 |
tccttttattcgctctgaaatccaatctatgaagaatcctccatctgttcttatcgtggatatct |
7404782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University