View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10107_low_19 (Length: 277)
Name: NF10107_low_19
Description: NF10107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10107_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 16 - 270
Target Start/End: Original strand, 7340869 - 7341123
Alignment:
| Q |
16 |
atatacctagcaaatttccttaatttttcaatttcatcttcagtgccaccaccaactattgctcccataacaaccgcggcttctaataaagccgcggttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7340869 |
atatacctagcaaatttccttaatttttcaatttcatcttcagtgccaccaccaactattgctcccataacaaccgcggcttctaataaagccgcggttt |
7340968 |
T |
 |
| Q |
116 |
tacgaagatgaataaactctagtgtctctaattccacgtttgattttccttctgattccaaatcaacaatttgtccagcaactagtccttcttttccaac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7340969 |
tacgaagatgaataaactctagtgtctctaatcccacgtttgattttccttctgattccaaatcaacaatttgtccagcaactagtccttcttttccaac |
7341068 |
T |
 |
| Q |
216 |
agcttttgccagctcagcaattgctctaacaattctttcaggtgggacccctatg |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7341069 |
agcttttgccagctcagcaattgctctaacaattctttcaggtgggacccctatg |
7341123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University