View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10107_low_22 (Length: 261)
Name: NF10107_low_22
Description: NF10107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10107_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 81 - 244
Target Start/End: Complemental strand, 9311083 - 9310920
Alignment:
| Q |
81 |
ttcatcaatattgagttacttttgtttggaaacccttaatgaagctacgttaattcctaaagatagtatttcgtcttgacccataggtaagctgatagag |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| || |
|
|
| T |
9311083 |
ttcatcaatattgagttacttttgtttggaaacccttaacgaaactacgttaattcctaaaggtagtatttcgtcttgacccataggtaagctgataaag |
9310984 |
T |
 |
| Q |
181 |
gtcaaactggtagcagtcgttttataattcattgtggcccaaatgacttcttatctactgatct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9310983 |
gtcaaactggtagcagtcgttttataattcattgtggcccaaatgacttcttatctactgatct |
9310920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University