View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10107_low_32 (Length: 242)
Name: NF10107_low_32
Description: NF10107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10107_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 33505087 - 33504848
Alignment:
Q |
1 |
tattactatgcatgttaactatatatgcaaatattaattaatattttggttactaaattattaggaaactgaaaatctcggtagagaaattggtggaaga |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
33505087 |
tattactatgcatgttaactatatatgcaaatattaattaatattttggttactaaattattaggaaactggaaatctcggtagagaaattggtggaaga |
33504988 |
T |
 |
Q |
101 |
ttttgaacaaggatggactccagatgcaggaaactattgcaaaaatttagttgaatttggtagtgggaaggctctaactcaaatgtgccgtaacatagag |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33504987 |
ttttgaacaaggatggactccagatgcaggaaactattgcaaaaatttagttgaatttggtagtgggaaggctctaactcaaatgtgccgtaacatagag |
33504888 |
T |
 |
Q |
201 |
gaagagatcaataatggttcatttagtaggttatcctatg |
240 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33504887 |
gaagagatcaataatggttcatttagtaggttatcctatg |
33504848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University