View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10107_low_33 (Length: 240)
Name: NF10107_low_33
Description: NF10107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10107_low_33 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 4 - 225
Target Start/End: Original strand, 31060810 - 31061031
Alignment:
| Q |
4 |
cctattgttgttttgccggagccacacattccccatatccctatcctatcatacaaactttgcttgattgatcatcaataaattcagtagtccaatataa |
103 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31060810 |
cctattgttgttttcccagagccacacattccccatatccctatcctatcatacaaactttgcttgattgatcatcaataaattcagtagtctaatataa |
31060909 |
T |
|
| Q |
104 |
gcatactatgcagcacgaacactcattggattaggcttgccacagtgtccgacacacatcagtgtccgacattaacacggcatacataattacattgaat |
203 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||||||||| ||||| ||||||||| |||||| | ||||||||||||||||||||||||| |
|
|
| T |
31060910 |
gcatactatgaagcacggacactcattggattaggcttgccacagtgtctgacacgcatcagtgtacgacatcagcacggcatacataattacattgaat |
31061009 |
T |
|
| Q |
204 |
tatgtgtttctcgaattattat |
225 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31061010 |
tatgtgtttctcgaattattat |
31061031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University