View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10107_low_42 (Length: 216)
Name: NF10107_low_42
Description: NF10107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10107_low_42 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 33385818 - 33386034
Alignment:
| Q |
1 |
cgttcttgataacgacgccgaaattgttatcgctgcctgattgatgcaaatcctgctgcattaacatataaccatatttgactgaatatgcatgcttttg |
100 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33385818 |
cgttcttgataacgacaccaaaattgttatcgctgcctgattgatgcaaatcctgctgcattaacatataaccatatttgactgaatatgcatgcttttg |
33385917 |
T |
 |
| Q |
101 |
atttgaatctccatgtcgctttccccttgtggaggagcgattcctgcaattagattaagcagatatgcaaaaat-aaaccctcgcatacaaatagaggtc |
199 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33385918 |
atttgaatctccatgttgctttccccttgtggaggagcgattcctgcaattagattaagcagatatgcaaaaataaaaccctcgcatacaaatagaggtc |
33386017 |
T |
 |
| Q |
200 |
tgcgccactccaatttc |
216 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33386018 |
tgcgccactccaatttc |
33386034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University