View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10108_high_16 (Length: 231)
Name: NF10108_high_16
Description: NF10108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10108_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 4337362 - 4337573
Alignment:
| Q |
1 |
aaagacttgccaggtaaattttaatttgagctgannnnnnnctcttgaaaactccatatccggcctaaggaccaactaatcc-gggggataaatcccact |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4337362 |
aaagacttgccaggtaaattttaatttgagctgatttttttctcttgaaaactccatatccggcctaaggaccaactaatccggggggataaatcccact |
4337461 |
T |
 |
| Q |
100 |
aaccactagc-gggggccccaattgctacaagaacaaagctttgtatctccattgggcccaacacaagaatttttggtacttggggaattcaaattcgat |
198 |
Q |
| |
|
|||||||||| ||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4337462 |
aaccactagcgggggggcccaattgctaccagaacaaagctttgtat---ggagcggcccaacacaagaatttttggtacttggggaattcaaattcgat |
4337558 |
T |
 |
| Q |
199 |
acctagagaagagca |
213 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
4337559 |
acctagagaagagca |
4337573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University