View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10108_high_4 (Length: 432)
Name: NF10108_high_4
Description: NF10108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10108_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 2e-68; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 45 - 180
Target Start/End: Complemental strand, 52987437 - 52987302
Alignment:
Q |
45 |
gaacgatttaaaccccacatttatttcttttttgatttcaaggtccctcacaaaactttccccaatttgacgatgaggtggtgagttttagtgacgtggc |
144 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52987437 |
gaacgatttaaaccccacatttatttcttttttgatttcaaggtccctcacaaaactttccccaatttgacgatgaggtggtgagttttagtgacgtggc |
52987338 |
T |
 |
Q |
145 |
atccttgtcactttggcaatgtggatactagtatac |
180 |
Q |
|
|
||||||||||||||| |||||||||||||||||||| |
|
|
T |
52987337 |
atccttgtcactttgccaatgtggatactagtatac |
52987302 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 325 - 416
Target Start/End: Complemental strand, 52987181 - 52987090
Alignment:
Q |
325 |
aagtctgttaattctgaatcttaaattagggttttgctttcaattcccaaatcatcattttcaccttcaattggtgtttgcctagccctatg |
416 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52987181 |
aagtctgttaattctgaatcttaaattagggttttgctttcaattcccaaatcatcattttcaccttcaattggtgtttgcctagccctatg |
52987090 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 244 - 286
Target Start/End: Complemental strand, 52987238 - 52987196
Alignment:
Q |
244 |
agaatccgggtcccaccttcttgacaccaaaacctatataaat |
286 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52987238 |
agaatccgggtcccaccttcttgacaccaaaacctatataaat |
52987196 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University