View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10108_low_21 (Length: 258)
Name: NF10108_low_21
Description: NF10108
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10108_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 5 - 189
Target Start/End: Complemental strand, 29174938 - 29174754
Alignment:
| Q |
5 |
gtgtgctcccacaatgcagttcactcagttcatcctcaagcaaaggatgtttgactcaaggacctatctgttgttgcacccactccgtcggtgaccaaca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29174938 |
gtgtgctcccacaatgcagttcactcagttcatcctcaagcaaaggatgtttgactcaaggacctatctgttgttgcacccactccgtcgatgaccaaca |
29174839 |
T |
|
| Q |
105 |
aattgatctccataatccaagacaaaattgaacaaaaaccataaaagcgtgataccaatcctgtacaaatctagaaggcatttaa |
189 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29174838 |
aattgatctccataatccaagacaaaatcgaacaaaaaccataaaagcgtgataccaatcctgaacaaatctagaaggcatttaa |
29174754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University